Gja1^em1Roms
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gja1^em1Roms
• Name: gap junction protein, alpha 1; endonuclease-mediated mutation 1, Robin M Shaw
• MGI ID: MGI:7639683
• Synonyms: GJA1^M213L
• Gene: Gja1 Location: Chr10:56253297-56266519 bp, + strand Genetic Position: Chr10, 28.64 cM
• Alliance: Gja1^em1Roms page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Nucleotide substitutions
• Mutation details: Methionine codon 213 (ATG) was changed to leucine (TTA) (p.M213L) using a crRNA (targeting ATTCAGAGCGAGAGACACGA), tracrRNA and an ssODN template with CRISPR/Cas9 technology. The mutation, in a highly conserved region, only affects the generation of the shorter 20k peptide isoform that uses this ATG as the start codon. (J:302491)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gja1 Mutation: 62 strains or lines available

References

• Original: J:302491 Xiao S, et al., Auxiliary trafficking subunit GJA1-20k protects connexin-43 from degradation and limits ventricular arrhythmias. J Clin Invest. 2020 Sep 1;130(9):4858-4870
• All: 2 reference(s)