Rabl2^em1Xiuy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rabl2^em1Xiuy
• Name: RAB, member RAS oncogene family-like 2; endonuclease-mediated mutation 1, Xiumin Yan
• MGI ID: MGI:7638797
• Synonyms: Rabl2^KI, Rabl2^Q80L
• Gene: Rabl2 Location: Chr15:89466736-89476126 bp, - strand Genetic Position: Chr15, 44.96 cM
• Alliance: Rabl2^em1Xiuy page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Constitutively active)
• Mutation: Nucleotide substitutions
• Mutation details: Glutamine codon 80 (CAG) in exon 5 was changed to leucine (TTG) (p.Q80L) using an sgRNA (GCAUGCUCUGGAACCGCUCC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide in a GTP-locked constitutively active state. (J:302201)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rabl2 Mutation: 13 strains or lines available

References

• Original: J:302201 Duan S, et al., Rabl2 GTP hydrolysis licenses BBSome-mediated export to fine-tune ciliary signaling. EMBO J. 2021 Jan 15;40(2):e105499
• All: 1 reference(s)