Mdm2^em2Stnj
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mdm2^em2Stnj
• Name: MDM2 proto-oncogene; endonuclease-mediated mutation 2, Stephen N Jones
• MGI ID: MGI:7628311
• Synonyms: Mdm2^S183A
• Gene: Mdm2 Location: Chr10:117524780-117546663 bp, - strand Genetic Position: Chr10, 66.32 cM, cytoband C1-C3
• Alliance: Mdm2^em2Stnj page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Serine codon 183 (TCC) in exon 9 was changed to alanine (GCC) (p.S183A) using an sgRNA (equivalent to GATCAAAGGACAGGGACCTGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation prevents phosphorylation of the residue in the encoded peptide. (J:301075)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mdm2 Mutation: 51 strains or lines available

References

• Original: J:301075 Chibaya L, et al., Mdm2 phosphorylation by Akt regulates the p53 response to oxidative stress to promote cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 2021 Jan 26;118(4):e2003193118
• All: 1 reference(s)