About   Help   FAQ
Mical1em1Mean
Endonuclease-mediated Allele Detail
Summary
Symbol: Mical1em1Mean
Name: microtubule associated monooxygenase, calponin and LIM domain containing 1; endonuclease-mediated mutation 1, Mark E Anderson
MGI ID: MGI:7628183
Synonyms: MICAL1R116H
Gene: Mical1  Location: Chr10:41352310-41363028 bp, + strand  Genetic Position: Chr10, 22.41 cM
Alliance: Mical1em1Mean page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsAlanine codon 116 (CGT) in exon 3 was changed to histidine (CAT) (p.R116H) using an sgRNA (equivalent to AAAAGCGTATCAAGTTCTCTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide unable to support F-actin depolymerization, while its ability to accelerate NADPH oxidation in the presence of Camk2 is unaffected. (J:299988)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mical1 Mutation:  49 strains or lines available
References
Original:  J:299988 Konstantinidis K, et al., MICAL1 constrains cardiac stress responses and protects against disease by oxidizing CaMKII. J Clin Invest. 2020 Sep 1;130(9):4663-4678
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory