Mical1em1Mean
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mical1em1Mean |
| Name: |
microtubule associated monooxygenase, calponin and LIM domain containing 1; endonuclease-mediated mutation 1, Mark E Anderson |
| MGI ID: |
MGI:7628183 |
| Synonyms: |
MICAL1R116H |
| Gene: |
Mical1 Location: Chr10:41352310-41363028 bp, + strand Genetic Position: Chr10, 22.41 cM
|
| Alliance: |
Mical1em1Mean page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Alanine codon 116 (CGT) in exon 3 was changed to histidine (CAT) (p.R116H) using an sgRNA (equivalent to AAAAGCGTATCAAGTTCTCTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide unable to support F-actin depolymerization, while its ability to accelerate NADPH oxidation in the presence of Camk2 is unaffected.
(J:299988)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mical1 Mutation: |
49 strains or lines available
|
|
| Original: |
J:299988 Konstantinidis K, et al., MICAL1 constrains cardiac stress responses and protects against disease by oxidizing CaMKII. J Clin Invest. 2020 Sep 1;130(9):4663-4678 |
| All: |
1 reference(s) |
|