About   Help   FAQ
Gcnt7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gcnt7em1(IMPC)J
Name: glucosaminyl (N-acetyl) transferase family member 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7624528
Gene: Gcnt7  Location: Chr2:172292233-172300516 bp, - strand  Genetic Position: Chr2, 94.87 cM
Alliance: Gcnt7em1(IMPC)J page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAGTGAAGAAGCTGGCGGG and ACAACAGAACATTTAGAGTA. This resulted in a 1,127 bp deletion of Chr2:172,453,871-172,454,997(GRCm38/mm10) that removes exon ENSMUSE00000638946. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gcnt7 Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory