Gcnt7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gcnt7^em1(IMPC)J
• Name: glucosaminyl (N-acetyl) transferase family member 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7624528
• Gene: Gcnt7 Location: Chr2:172292233-172300516 bp, - strand Genetic Position: Chr2, 94.87 cM
• Alliance: Gcnt7^em1(IMPC)J page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAGTGAAGAAGCTGGCGGG and ACAACAGAACATTTAGAGTA. This resulted in a 1,127 bp deletion of Chr2:172,453,871-172,454,997(GRCm38/mm10) that removes exon ENSMUSE00000638946. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gcnt7 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)