Ngf^em1Bshn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ngf^em1Bshn
• Name: nerve growth factor; endonuclease-mediated mutation 1, Bo Shen
• MGI ID: MGI:7624257
• Synonyms: Ngf^mScarlet
• Gene: Ngf Location: Chr3:102377235-102428329 bp, + strand Genetic Position: Chr3, 45.25 cM
• Alliance: Ngf^em1Bshn page

Mutation origin

• Strain of Origin: C57BL/6Ka

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: sgRNAs (CAATAGCTGCCCGAGTGACAGGG and AGTGTTTGGAGTCGATGCCCCGG)were designed to insert a red fluorescent protein (mScarlet) sequence, and woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) followed by a polyadenylation signal (mScarlet-WPRE-pA) after an alternative ATG start codon in exon 4, replacing most of the coding sequence in exon 4 of the endogenous nerve growth factor (Ngf) gene. (J:347437)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ngf Mutation: 13 strains or lines available

References

• Original: J:347437 Gao X, et al., Leptin receptor(+) cells promote bone marrow innervation and regeneration by synthesizing nerve growth factor. Nat Cell Biol. 2023 Nov 27
• All: 1 reference(s)