Spo11^em1Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spo11^em1Jcs
• Name: SPO11 initiator of meiotic double stranded breaks; endonuclease-mediated mutation 1, John C Schimenti
• MGI ID: MGI:7623838
• Synonyms: Spo11^P306T
• Gene: Spo11 Location: Chr2:172819493-172835369 bp, + strand Genetic Position: Chr2, 95.64 cM, cytoband H4
• Alliance: Spo11^em1Jcs page

Mutation origin

• Strain of Origin: (FVB/NJ x B6(Cg)-Tyr^c-2J/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Proline codon 306 (CCA) in exon 11 was changed to threonine (ACA) (p.P306T) using an sgRNA (corresponding to GACCAAGCCATCTGATTGTT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation, represented by SNP rs185545661. (J:279122)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Spo11 Mutation: 22 strains or lines available

References

• Original: J:279122 Tran TN, et al., A segregating human allele of SPO11 modeled in mice disrupts timing and amounts of meiotic recombination, causing oligospermia and a decreased ovarian reserve. Biol Reprod. 2019 Aug 1;101(2):347-359
• All: 1 reference(s)