About   Help   FAQ
Spo11em1Jcs
Endonuclease-mediated Allele Detail
Summary
Symbol: Spo11em1Jcs
Name: SPO11 initiator of meiotic double stranded breaks; endonuclease-mediated mutation 1, John C Schimenti
MGI ID: MGI:7623838
Synonyms: Spo11P306T
Gene: Spo11  Location: Chr2:172819493-172835369 bp, + strand  Genetic Position: Chr2, 95.64 cM, cytoband H4
Alliance: Spo11em1Jcs page
Mutation
origin
Strain of Origin:  (FVB/NJ x B6(Cg)-Tyrc-2J/J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsProline codon 306 (CCA) in exon 11 was changed to threonine (ACA) (p.P306T) using an sgRNA (corresponding to GACCAAGCCATCTGATTGTT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation, represented by SNP rs185545661. (J:279122)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Spo11 Mutation:  22 strains or lines available
References
Original:  J:279122 Tran TN, et al., A segregating human allele of SPO11 modeled in mice disrupts timing and amounts of meiotic recombination, causing oligospermia and a decreased ovarian reserve. Biol Reprod. 2019 Aug 1;101(2):347-359
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory