Arhgap35^em1Slp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap35^em1Slp
• Name: Rho GTPase activating protein 35; endonuclease-mediated mutation 1, Samuel L Pfaff
• MGI ID: MGI:7621681
• Synonyms: p190^R1284A
• Gene: Arhgap35 Location: Chr7:16228398-16349313 bp, - strand Genetic Position: Chr7, 9.15 cM
• Alliance: Arhgap35^em1Slp page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 1284 (CGG) in exon 4 was changed to alanine (GCA) (p.R1284A) using an sgRNA (equivalent to AAGCACTGAAGGCATCTACC) and an ssODN template with CRISPR/Cas9 technology. The mutation abolishes the GTPase-activating catalytic function of the encoded peptide. (J:276248)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Arhgap35 Mutation: 70 strains or lines available

References

• Original: J:276248 Bonanomi D, et al., p190RhoGAP Filters Competing Signals to Resolve Axon Guidance Conflicts. Neuron. 2019 May 8;102(3):602-620.e9
• All: 1 reference(s)