Tbc1d22b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbc1d22b^em1(IMPC)J
• Name: TBC1 domain family, member 22B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7621328
• Gene: Tbc1d22b Location: Chr17:29768765-29825868 bp, + strand Genetic Position: Chr17, 15.43 cM
• Alliance: Tbc1d22b^em1(IMPC)J page
• IMPC: Tbc1d22b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAGGAAGTTAGACGCCCCA and GTAGGAATATACTCACCTGC. This resulted in a 1,433 bp. deletion of Chr17:29,570,497-29,571,929 (GRCm38/mm10) and removes exons ENSMUSE00000417027 and ENSMUSE00000417022. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tbc1d22b Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)