Ccdc68^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc68^em1(IMPC)J
• Name: coiled-coil domain containing 68; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7621323
• Gene: Ccdc68 Location: Chr18:70058497-70102555 bp, + strand Genetic Position: Chr18, 43.78 cM
• Alliance: Ccdc68^em1(IMPC)J page
• IMPC: Ccdc68 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATAGTAACCATGTGCCACCA and TTTCCTGTTTGTGGCTGGGC. This resulted in a 257 bp. deletion of Chr18:69,955,856-69,956,112 (GRCm38/mm10) and removes exons ENSMUSE00000326539. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc68 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)