Igs77^em1Aven
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igs77^em1Aven
• Name: intergenic site 77; endonuclease-mediated mutation 1, Andrea Ventura
• MGI ID: MGI:7620005
• Gene: Igs77 Location: Chr15:60517993-60517994 bp Genetic Position: Chr15, Syntenic
• Alliance: Igs77^em1Aven page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Insertion
• Mutation details: Using CRISPR/Cas9 technology, a guide RNAs (AGATGCGCACAGAAAAGTGG and ATCATGAGTTGAGTTCACTC) were designed to insert loxP sites flanking a 1.7 Mbp genomic region on chromosome 15 (chr15:60646144-62380008) containing the myelocytomatosis oncogene (Myc) gene. This allele is a proximal loxP insertion site that pairs with Igs78. (J:346905)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Igs77 Mutation: 1 strain or line available

References

• Original: J:346905 Pradella D, et al., Immortalization and transformation of primary cells mediated by engineered ecDNAs. bioRxiv. 2023
• All: 2 reference(s)