Slc13a5em3(SLC13A5*)Lutzy
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc13a5em3(SLC13A5*)Lutzy |
| Name: |
solute carrier family 13 (sodium-dependent citrate transporter), member 5; endonuclease-mediated mutation 3, Cathy Lutz |
| MGI ID: |
MGI:7619936 |
| Gene: |
Slc13a5 Location: Chr11:72132815-72158048 bp, - strand Genetic Position: Chr11, 43.95 cM
|
| Alliance: |
Slc13a5em3(SLC13A5*)Lutzy page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence, Inserted expressed sequence, Null/knockout) |
| Mutation: |
|
Insertion
|
| |
|
Slc13a5em3(SLC13A5*)Lutzy expresses
1 gene
Knock-in expresses:
| Organism |
Expressed Gene |
Homolog in Mouse |
Note |
| human |
SLC13A5 (284111) |
|
|
|
| |
|
Mutation details: CRISPR/cas9 endonuclease-mediated genome editing used a guide RNAs (CGCCGAATCCATCGCGTGAA, GCCGAATCCATCGCGTGAAA, TGCGTGTCTGGGCAGCCTGG, AGTTGCGTGTCTGGGCAGCC) to excise and replace coding murine exon 1 of the Slc13a5 with a full-length 568 amino acid human SLC13A5 cDNA with G219R missense variant and bGH poly(A) transcription termination signal. The insertion prevents translation of the mouse Slc13a5 cDNA. Slc13a5 transcript Slc13a5-201 (ENSMUST00000021161.14) was used as reference for the exon number and guide sequences.
(J:94077)
|
|
|
|
|
| Original: |
J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015; |
| All: |
1 reference(s) |
|