Impg1^em1Bdph
Endonuclease-mediated Allele Detail

Summary

• Symbol: Impg1^em1Bdph
• Name: interphotoreceptor matrix proteoglycan 1; endonuclease-mediated mutation 1, Benjamin Philpot
• MGI ID: MGI:7619087
• Synonyms: Impg1 KO
• Gene: Impg1 Location: Chr9:80220612-80347534 bp, - strand Genetic Position: Chr9, 43.99 cM
• Alliance: Impg1^em1Bdph page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 5 was deleted using two sgRNAs targeting introns 4 (CTGTTGTGGACCGAATACAG) and 5 (TTCAAATCGCTAATTTCTCA) and an ssODN template (for the desired deletion junction) with CRISPR/Cas9 technology. (J:346749)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Impg1 Mutation: 48 strains or lines available

References

• Original: J:346749 Williams BN, et al., Heterogeneity in the progression of retinal pathologies in mice harboring patient mimicking Impg2 mutations. Hum Mol Genet. 2024 Feb 18;33(5):448-464
• All: 1 reference(s)