About   Help   FAQ
Impg2em2Bdph
Endonuclease-mediated Allele Detail
Summary
Symbol: Impg2em2Bdph
Name: interphotoreceptor matrix proteoglycan 2; endonuclease-mediated mutation 2, Benjamin Philpot
MGI ID: MGI:7619043
Synonyms: Impg2Y250C
Gene: Impg2  Location: Chr16:56024676-56094119 bp, + strand  Genetic Position: Chr16, 33.91 cM
Alliance: Impg2em2Bdph page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsTyrosine codon 250 (TAC) in exon 8 was changed to cysteine (TGC) (p.Y250C) using an sgRNA (equivalent to GATCGCTTCCCCAGAAGTTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of human p.Y254C mutation associated with adult-onset vitelliform macular dystrophy (AVMD) and retinitis pigmentosa (RP). (J:346749)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Impg2 Mutation:  69 strains or lines available
References
Original:  J:346749 Williams BN, et al., Heterogeneity in the progression of retinal pathologies in mice harboring patient mimicking Impg2 mutations. Hum Mol Genet. 2024 Feb 18;33(5):448-464
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory