Ggact^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ggact^em1(IMPC)J
• Name: gamma-glutamylamine cyclotransferase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7618375
• Gene: Ggact Location: Chr14:123128272-123150901 bp, - strand Genetic Position: Chr14, 66.04 cM
• Alliance: Ggact^em1(IMPC)J page
• IMPC: Ggact gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCCCCGGGAAAACAGATAAA and ATGGCCCACATCTTCGTGTA. This resulted in a 440 bp internal deletion of Chr14:122,891,347-122,891,786 (GRCm38/mm10) that removes exon ENSMUSE00000332841. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ggact Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)