Brcc3^em1Roag
Endonuclease-mediated Allele Detail

Summary

• Symbol: Brcc3^em1Roag
• Name: BRCA1/BRCA2-containing complex, subunit 3; endonuclease-mediated mutation 1, Roger A Greenberg
• MGI ID: MGI:7612576
• Synonyms: Brcc36^E33A
• Gene: Brcc3 Location: ChrX:74460234-74497607 bp, + strand Genetic Position: ChrX, 38.22 cM
• Alliance: Brcc3^em1Roag page

Mutation origin

• Strain of Origin: (C57BL/6 x SJL)F1/J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Glutamic acid codon 33 (GAA) in exon 1 was changed to alanine (GCA) (p.E33A) using an sgRNA (targeting AGTGATGGGTCTGTGTATAG) and an ssODN template with CRISPR/Cas9 technology. The mutation abolishes the deubiquitylating enzymatic activity of the encoded peptide. (J:345315)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Brcc3 Mutation: 11 strains or lines available

References

• Original: J:345315 Jiang Q, et al., Autologous K63 deubiquitylation within the BRCA1-A complex licenses DNA damage recognition. J Cell Biol. 2022 Sep 5;221(9)
• All: 1 reference(s)