Acta2^em1Dmmz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acta2^em1Dmmz
• Name: actin alpha 2, smooth muscle, aorta; endonuclease-mediated mutation 1, Dianna M Milewicz
• MGI ID: MGI:7612356
• Synonyms: Acta2^R149C
• Gene: Acta2 Location: Chr19:34218490-34232990 bp, - strand Genetic Position: Chr19, 29.41 cM, cytoband C3
• Alliance: Acta2^em1Dmmz page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Single point mutation
• Mutation details: Arginine codon 149 (CGT) in exon was changed to cysteine (TGT) (p.R149C) using an sgRNA (targeting TGGACGTACAACTGGTAGGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with heritable thoracic aortic disease (HTAD). (J:345345)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Acta2 Mutation: 56 strains or lines available

References

• Original: J:345345 Chen J, et al., Resistance of Acta2(R149C/+) mice to aortic disease is associated with defective release of mutant smooth muscle alpha-actin from the chaperonin-containing TCP1 folding complex. J Biol Chem. 2021 Dec;297(6):101228
• All: 2 reference(s)