Mir678em1(IMPC)Ics
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mir678em1(IMPC)Ics |
| Name: |
microRNA 678; endonuclease-mediated mutation 1, Mouse Clinical Institute |
| MGI ID: |
MGI:7610745 |
| Gene: |
Mir678 Location: Chr10:76043160-76043243 bp, - strand Genetic Position: Chr10, 38.74 cM
|
| Alliance: |
Mir678em1(IMPC)Ics page
|
| IMPC: |
Mir678 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences ATGTCCGCATCTTGTGTCAG and CTACCCATGCAGAGTCCACT that targeted exon(s) ENSMUSE00000575515.3 ENSMUSE00000660428.2 ENSMUSE00000984755.2 ENSMUSE00001234161.2. This resulted in deletion(s) of 135 bp (location: Chr10:76043151-76043285; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|