Pbx4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pbx4^em1(IMPC)J
• Name: pre B cell leukemia homeobox 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7610650
• Gene: Pbx4 Location: Chr8:70285141-70324942 bp, + strand Genetic Position: Chr8, 33.92 cM, cytoband C
• Alliance: Pbx4^em1(IMPC)J page
• IMPC: Pbx4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAAAAGTAGCCAGGACCAAG and CGTGCCACTGGGGTCCCCGA. This resulted in a 788 bp deletion of region Chr8:69,864,255-69,865,042 (GRCm38/mm10) that removes exons ENSMUSE00000214007 and ENSMUSE00000607410. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pbx4 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)