Cldnd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cldnd1^em1(IMPC)J
• Name: claudin domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7610647
• Gene: Cldnd1 Location: Chr16:58548269-58554610 bp, + strand Genetic Position: Chr16, 34.83 cM
• Alliance: Cldnd1^em1(IMPC)J page
• IMPC: Cldnd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences:GCATTGCGTTATGGAAAGAA and CCTTCCTCAGAAACGTTCCA. This resulted in a 2,197 bp internal deletion of Chr16:58,729,335-58,731,531(GRCm38/mm10) and removes exons ENSMUSE00001232279 and ENSMUSE00001232574. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cldnd1 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)