Ttc27^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttc27^em1(IMPC)J
• Name: tetratricopeptide repeat domain 27; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7608147
• Gene: Ttc27 Location: Chr17:75024730-75170565 bp, + strand Genetic Position: Chr17, 45.64 cM
• Alliance: Ttc27^em1(IMPC)J page
• IMPC: Ttc27 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AAATGATATTGATGCTTGCT and GCAACGATTTAAAGGATCAG. This resulted in a 374 bp deletion of region Chr17:74,747,534-74,747,907 (GRCm38/mm10) and removes exon ENSMUSE00000138115. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ttc27 Mutation: 59 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)