About   Help   FAQ
Ttc27em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttc27em1(IMPC)J
Name: tetratricopeptide repeat domain 27; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7608147
Gene: Ttc27  Location: Chr17:75024730-75170565 bp, + strand  Genetic Position: Chr17, 45.64 cM
Alliance: Ttc27em1(IMPC)J page
IMPC: Ttc27 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AAATGATATTGATGCTTGCT and GCAACGATTTAAAGGATCAG. This resulted in a 374 bp deletion of region Chr17:74,747,534-74,747,907 (GRCm38/mm10) and removes exon ENSMUSE00000138115. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ttc27 Mutation:  61 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory