P2ry10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: P2ry10^em1(IMPC)J
• Name: purinergic receptor P2Y, G-protein coupled 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7608141
• Gene: P2ry10 Location: ChrX:106132098-106148580 bp, + strand Genetic Position: ChrX, 47.43 cM
• Alliance: P2ry10^em1(IMPC)J page
• IMPC: P2ry10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATATTTCAGTATGTTTGGCA and CGTCTCATGAGCAGGGAGAG. This resulted in a 988 bp internal deletion of ChrX:107,102,438-107,103,425 (GRCm38/mm10) and removes most of exon ENSMUSE00000383594 and has a 1 bp insertion at ChrX:107,102,459. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any P2ry10 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)