About   Help   FAQ
P2ry10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: P2ry10em1(IMPC)J
Name: purinergic receptor P2Y, G-protein coupled 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7608141
Gene: P2ry10  Location: ChrX:106132098-106148580 bp, + strand  Genetic Position: ChrX, 47.43 cM
Alliance: P2ry10em1(IMPC)J page
IMPC: P2ry10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATATTTCAGTATGTTTGGCA and CGTCTCATGAGCAGGGAGAG. This resulted in a 988 bp internal deletion of ChrX:107,102,438-107,103,425 (GRCm38/mm10) and removes most of exon ENSMUSE00000383594 and has a 1 bp insertion at ChrX:107,102,459. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any P2ry10 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory