Ccdc13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc13^em1(IMPC)J
• Name: coiled-coil domain containing 13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7608139
• Gene: Ccdc13 Location: Chr9:121626693-121668527 bp, - strand Genetic Position: Chr9, 72.63 cM, cytoband F4
• Alliance: Ccdc13^em1(IMPC)J page
• IMPC: Ccdc13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGACTGCTCTAAGGCTACAA and CAGCTGTTCAGAGCATCAGC. This resulted in a 2,600 bp deletion of Chr9:121,824,851-121,827,450 (GRCm38/mm10) and removes exons ENSMUSE00001302039 and ENSMUSE00001242639 (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc13 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)