Hmgcs2^em1Lmjn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hmgcs2^em1Lmjn
• Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2; endonuclease-mediated mutation 1, Lauryl Nutter
• MGI ID: MGI:7595717
• Gene: Hmgcs2 Location: Chr3:98187751-98218054 bp, + strand Genetic Position: Chr3, 42.74 cM
• Alliance: Hmgcs2^em1Lmjn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences CTAATATTACGCTTGAAAGT and GTGCCTGACTGTAGATGAGA. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exon ENSMUSE00000513987 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:345353)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hmgcs2 Mutation: 36 strains or lines available

References

• Original: J:345353 Nutter L, Direct Data Submissions for Lauryl Nutter. 2024
• All: 1 reference(s)