About   Help   FAQ
Hmgcs2em1Lmjn
Endonuclease-mediated Allele Detail
Summary
Symbol: Hmgcs2em1Lmjn
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2; endonuclease-mediated mutation 1, Lauryl Nutter
MGI ID: MGI:7595717
Gene: Hmgcs2  Location: Chr3:98187751-98218054 bp, + strand  Genetic Position: Chr3, 42.74 cM
Alliance: Hmgcs2em1Lmjn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation details: 

This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences CTAATATTACGCTTGAAAGT and GTGCCTGACTGTAGATGAGA. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exon ENSMUSE00000513987 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:345353)

Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Hmgcs2 Mutation:  37 strains or lines available
References
Original:  J:345353 Nutter L, Direct Data Submissions for Lauryl Nutter. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory