Olfml2a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Olfml2a^em1(IMPC)J
• Name: olfactomedin-like 2A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7593977
• Gene: Olfml2a Location: Chr2:38821992-38850597 bp, + strand Genetic Position: Chr2, 24.42 cM
• Alliance: Olfml2a^em1(IMPC)J page
• IMPC: Olfml2a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGCTTGAGACCCAATCCGGT and CCTTTGCTCAACCATACACT. This resulted in a 592 bp deletion of Chr2:38,950,954-38,951,545 (GRCm38/mm10) and removes exon ENSMUSE00000336635. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Olfml2a Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)