Dnmt3a^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnmt3a^em1Tcp
• Name: DNA methyltransferase 3A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7587755
• Gene: Dnmt3a Location: Chr12:3856007-3964443 bp, + strand Genetic Position: Chr12, 1.99 cM, cytoband A2-A3
• Alliance: Dnmt3a^em1Tcp page
• IMPC: Dnmt3a gene page

Mutation origin

• Strain of Origin: C57BL/6J
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence CTCCAATCACCAGGTCGAAT and a single-strand oligonucleotide encoding the changes c.2113-2114CC>GT [p.P705A] and c.2116-2117TG>GA [p.C706D], and c.2085C>A to inactivate the PAM sequence and prevent re-cutting of the repaired allele in ENSMUST00000020991 (GRCm39).
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dnmt3a Mutation: 140 strains or lines available

References

• Original: J:23000 MGD Nomenclature Committee, Nomenclature Committee Use. 1995-02-14
• All: 1 reference(s)