About   Help   FAQ
Kcng1em2Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcng1em2Tcp
Name: potassium voltage-gated channel, subfamily G, member 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:7587753
Gene: Kcng1  Location: Chr2:168102037-168123453 bp, - strand  Genetic Position: Chr2, 88.55 cM
Alliance: Kcng1em2Tcp page
IMPC: Kcng1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences AGGTGGCGCTGACTTAACAT and GACACTAGGGACAACAACTG and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking the coding region; the 5' loxP site is upstream of the first coding exon (ENSMUSE00000639008) and the 3' loxP is 16bp 3' of the stop codon (GRCm38). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:200814)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kcng1 Mutation:  29 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory