Kcng1^em2Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcng1^em2Tcp
• Name: potassium voltage-gated channel, subfamily G, member 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:7587753
• Gene: Kcng1 Location: Chr2:168102037-168123453 bp, - strand Genetic Position: Chr2, 88.55 cM
• Alliance: Kcng1^em2Tcp page
• IMPC: Kcng1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences AGGTGGCGCTGACTTAACAT and GACACTAGGGACAACAACTG and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking the coding region; the 5' loxP site is upstream of the first coding exon (ENSMUSE00000639008) and the 3' loxP is 16bp 3' of the stop codon (GRCm38). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:200814)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kcng1 Mutation: 29 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)