Trim33em1Lmjn
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Trim33em1Lmjn |
| Name: |
tripartite motif-containing 33; endonuclease-mediated mutation 1, Lauryl Nutter |
| MGI ID: |
MGI:7580737 |
| Gene: |
Trim33 Location: Chr3:103186609-103266086 bp, + strand Genetic Position: Chr3, 45.25 cM
|
| Alliance: |
Trim33em1Lmjn page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TATGTAATCGGCAACATCGC targeting the 5' side and AAACTCTACCTCAGGTTCGA targeting the 3' side of a critical region (ENSMUSE00000494738). This resulted in a 3950-bp deletion of Chr3 from 103242223 to103245812 (GRCm39) introducing a frameshift and a premature stop codon.
(J:344138)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Trim33 Mutation: |
76 strains or lines available
|
|
| Original: |
J:344138 The Centre for Phenogenomics, Strains and alleles submitted by The Centre for Phenogenomics. MGI Direct Data Submission. 2024; |
| All: |
1 reference(s) |
|