Cdc20^em1Jgte
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdc20^em1Jgte
• Name: cell division cycle 20; endonuclease-mediated mutation 1, Jose G Teodoro
• MGI ID: MGI:7580667
• Synonyms: Cdc20^N331K
• Gene: Cdc20 Location: Chr4:118290098-118294540 bp, - strand Genetic Position: Chr4, 54.61 cM
• Alliance: Cdc20^em1Jgte page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Asparagine codon 331 (AAC) in exon 7 was changed to lysine (AAG) (c.993C>G, p.N331K) using an sgRNA (targeting ATGATAACATTGTCAACGTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation (GRCh37:chr1:43826548C>G, NM_001255.2:c.993C>G, NP_001246.2:p.N331K) associated with familial malignant ovarian germ cell tumors (mOGCT). (J:330136)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cdc20 Mutation: 30 strains or lines available

References

• Original: J:330136 Chen OJ, et al., Germline Missense Variants in CDC20 Result in Aberrant Mitotic Progression and Familial Cancer. Cancer Res. 2022 Oct 4;82(19):3499-3515
• All: 1 reference(s)