Kdm2b^em1Xuwu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kdm2b^em1Xuwu
• Name: lysine (K)-specific demethylase 2B; endonuclease-mediated mutation 1, Xudong Wu
• MGI ID: MGI:7578911
• Synonyms: Kdm2b-H283A
• Gene: Kdm2b Location: Chr5:123008727-123127333 bp, - strand Genetic Position: Chr5, 62.63 cM, cytoband F
• Alliance: Kdm2b^em1Xuwu page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Histidine codon 283 (CAT) in exon 9 was changed to alanine (GCT) (p.H283A) using an sgRNA (targeting TGGACTCTCTGGTGTTCGGC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide catalytically inactive. (J:342729)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kdm2b Mutation: 219 strains or lines available

References

• Original: J:342729 Huo D, et al., CpG island reconfiguration for the establishment and synchronization of polycomb functions upon exit from naive pluripotency. Mol Cell. 2022 Mar 17;82(6):1169-1185.e7
• All: 1 reference(s)