About   Help   FAQ
Arid5bem1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Arid5bem1Tcp
Name: AT-rich interaction domain 5B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7574121
Gene: Arid5b  Location: Chr10:67928350-68114570 bp, - strand  Genetic Position: Chr10, 35.14 cM, cytoband B5.1
Alliance: Arid5bem1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences GCAAGTACTCAAGTCTAGCA and AGCTCAAAGTTGCTACAAAC. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exon ENSMUSE00000099312 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arid5b Mutation:  141 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory