Arid5bem1Tcp
Endonuclease-mediated Allele Detail
|
Symbol: |
Arid5bem1Tcp |
Name: |
AT-rich interaction domain 5B; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
MGI ID: |
MGI:7574121 |
Gene: |
Arid5b Location: Chr10:67928350-68114570 bp, - strand Genetic Position: Chr10, 35.14 cM, cytoband B5.1
|
Alliance: |
Arid5bem1Tcp page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Conditional ready, No functional change) |
Mutation: |
|
Insertion
|
|
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences GCAAGTACTCAAGTCTAGCA and AGCTCAAAGTTGCTACAAAC. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exon ENSMUSE00000099312 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele.
(J:322048)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022; |
All: |
1 reference(s) |
|