Lama2em1Tcp
Endonuclease-mediated Allele Detail
|
Symbol: |
Lama2em1Tcp |
Name: |
laminin, alpha 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
MGI ID: |
MGI:7572895 |
Gene: |
Lama2 Location: Chr10:26857281-27493021 bp, - strand Genetic Position: Chr10, 14.23 cM, cytoband A4-B1
|
Alliance: |
Lama2em1Tcp page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Conditional ready, No functional change) |
Mutation: |
|
Insertion
|
|
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences CTATGATAGATAGTGCCCAT and CTGATCTTAGAATATCAATT. Recombinant AAV was used to deliver a single repair template containing the loxP sites, critical region, and flanking homology arms. The resulting allele has loxP sites flanking exon 8 (ENSMUSE00000334936) (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele.
(J:322048)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022; |
All: |
1 reference(s) |
|