Lama2^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lama2^em1Tcp
• Name: laminin, alpha 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7572895
• Gene: Lama2 Location: Chr10:26857281-27493021 bp, - strand Genetic Position: Chr10, 14.23 cM, cytoband A4-B1
• Alliance: Lama2^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences CTATGATAGATAGTGCCCAT and CTGATCTTAGAATATCAATT. Recombinant AAV was used to deliver a single repair template containing the loxP sites, critical region, and flanking homology arms. The resulting allele has loxP sites flanking exon 8 (ENSMUSE00000334936) (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lama2 Mutation: 177 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)