About   Help   FAQ
Lama2em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Lama2em1Tcp
Name: laminin, alpha 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7572895
Gene: Lama2  Location: Chr10:26857281-27493021 bp, - strand  Genetic Position: Chr10, 14.23 cM, cytoband A4-B1
Alliance: Lama2em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences CTATGATAGATAGTGCCCAT and CTGATCTTAGAATATCAATT. Recombinant AAV was used to deliver a single repair template containing the loxP sites, critical region, and flanking homology arms. The resulting allele has loxP sites flanking exon 8 (ENSMUSE00000334936) (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lama2 Mutation:  178 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory