Tnfrsf1a^em3Tomm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnfrsf1a^em3Tomm
• Name: tumor necrosis factor receptor superfamily, member 1a; endonuclease-mediated mutation 3, Tomoyuki Mukai
• MGI ID: MGI:7572890
• Synonyms: Tnfrsf1a T90I
• Gene: Tnfrsf1a Location: Chr6:125326686-125339446 bp, + strand Genetic Position: Chr6, 59.32 cM
• Alliance: Tnfrsf1a^em3Tomm page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Threonine exon 90 (ACG) in exon 3 was changed to isoleucine (ATA) (p.T90I) using a crRNA (targeting CCTTTACGGCTTCCCAGAATTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation with unknown significance in relation to tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS). (J:342733)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tnfrsf1a Mutation: 50 strains or lines available

References

• Original: J:342733 Akagi T, et al., TRAPS mutations in Tnfrsf1a decrease the responsiveness to TNFalpha via reduced cell surface expression of TNFR1. Front Immunol. 2022;13:926175
• All: 1 reference(s)