About   Help   FAQ
Tnfrsf1aem2Tomm
Endonuclease-mediated Allele Detail
Summary
Symbol: Tnfrsf1aem2Tomm
Name: tumor necrosis factor receptor superfamily, member 1a; endonuclease-mediated mutation 2, Tomoyuki Mukai
MGI ID: MGI:7572889
Synonyms: Tnfrsf1a G87V
Gene: Tnfrsf1a  Location: Chr6:125326686-125339446 bp, + strand  Genetic Position: Chr6, 59.32 cM
Alliance: Tnfrsf1aem2Tomm page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsGlycine exon 87 (GGC) in exon 3 was changed to valine (GTG) (p.G87V) using a crRNA (targeting GTCTGCAGGGAGTGTGAAAAGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS). (J:342733)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tnfrsf1a Mutation:  51 strains or lines available
References
Original:  J:342733 Akagi T, et al., TRAPS mutations in Tnfrsf1a decrease the responsiveness to TNFalpha via reduced cell surface expression of TNFR1. Front Immunol. 2022;13:926175
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory