Astl^em3Lwa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Astl^em3Lwa
• Name: astacin like metalloendopeptidase; endonuclease-mediated mutation 3, Lei Wang
• MGI ID: MGI:7568005
• Synonyms: Astl^R274W
• Gene: Astl Location: Chr2:127180559-127199571 bp, + strand Genetic Position: Chr2, 61.93 cM, cytoband F
• Alliance: Astl^em3Lwa page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 274 (CGG) in exon 8 was changed to tryptophan (TGG) (c.820C>T, p.R274W) using an sgRNA (targeting GCAGACCCGGGTGATATCTGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility. (J:342780)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Astl Mutation: 23 strains or lines available

References

• Original: J:342780 Zeng Y, et al., Bi-allelic variants in ASTL cause abnormal fertilization or oocyte maturation defects. Hum Mol Genet. 2023 Jul 4;32(14):2326-2334
• All: 1 reference(s)