Mybpc3^em1Dwdk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mybpc3^em1Dwdk
• Name: myosin binding protein C, cardiac; endonuclease-mediated mutation 1, Diederik W D Kuster
• MGI ID: MGI:7567398
• Synonyms: MYBPC3^2373insG, Mybpc3^c.2373insG
• Gene: Mybpc3 Location: Chr2:90948489-90966861 bp, + strand Genetic Position: Chr2, 50.44 cM, cytoband E1
• Alliance: Mybpc3^em1Dwdk page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Insertion
• Mutation details: A single G nucleotide was inserted/duplicated in exon 24 (ENSMUST00000111430:c.2382dupG, GRCm39:chr2:90961782dupG) using an sgRNA (targeting GGACTCCTGCACTGTGCAGTGGG) and an ssODN template with CRISPR/Cas9 technology. No protein expression was found from this allele in the left heart ventricle. The mutation creates a novel splice donor site (G-GT) the middle of the exon, the use of which leads to anomalous splicing, frameshift and premature stop codon; if the splice site is not used, the mutation will also create a frameshift and premature stop codon. It is the equivalent of a human c.2373insG (c.2373dupG) mutation associated with hypertrophic cardiomyopathy (HCM). (J:342830)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mybpc3 Mutation: 41 strains or lines available

References

• Original: J:342830 Schuldt M, et al., Proteomic and Functional Studies Reveal Detyrosinated Tubulin as Treatment Target in Sarcomere Mutation-Induced Hypertrophic Cardiomyopathy. Circ Heart Fail. 2021 Jan;14(1):e007022
• All: 3 reference(s)