About   Help   FAQ
Smpd1em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Smpd1em1Tcp
Name: sphingomyelin phosphodiesterase 1, acid lysosomal; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7565732
Gene: Smpd1  Location: Chr7:105203567-105207596 bp, + strand  Genetic Position: Chr7, 55.9 cM
Alliance: Smpd1em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsThis allele from project TCPR0530 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence CTCTGTGGTGGGGCATTGCC and a single-strand oligonucleotde encoding a 3xFLAG tag followed by a flexible linker (GGGGS). The 3xFLAG-linker was inserted adjacent to the ATG codon of Smpd14 after Chr7:105554534. (J:322048)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Smpd1 Mutation:  25 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory