Smpd1^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smpd1^em1Tcp
• Name: sphingomyelin phosphodiesterase 1, acid lysosomal; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7565732
• Gene: Smpd1 Location: Chr7:105203567-105207596 bp, + strand Genetic Position: Chr7, 55.9 cM
• Alliance: Smpd1^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: This allele from project TCPR0530 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence CTCTGTGGTGGGGCATTGCC and a single-strand oligonucleotde encoding a 3xFLAG tag followed by a flexible linker (GGGGS). The 3xFLAG-linker was inserted adjacent to the ATG codon of Smpd14 after Chr7:105554534. (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Smpd1 Mutation: 22 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)