About   Help   FAQ
Col1a1em1Lmjn
Endonuclease-mediated Allele Detail
Summary
Symbol: Col1a1em1Lmjn
Name: collagen, type I, alpha 1; endonuclease-mediated mutation 1, Lauryl Nutter
MGI ID: MGI:7565728
Synonyms: Col1a1em2Tcp
Gene: Col1a1  Location: Chr11:94827050-94843868 bp, + strand  Genetic Position: Chr11, 59.01 cM, cytoband D
Alliance: Col1a1em1Lmjn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence GAGGTTCATGAGCCCTCAAA and an AAV repair template to insert a Bxb1 IMCE cassette comprised of a Bxb1 attP-GT site, a spacer sequence, and a Bxb1 attP-GA stie. This resulted in insertion of the Bxb1 IMCE cassette after Chr11:94844348 (GRCm39). This insertion should enable Bxb1 integrase-mediated cassette exchange with an appropriate vector and Bxb1 mRNA. (J:322048)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Col1a1 Mutation:  166 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory