Col1a1em1Lmjn
Endonuclease-mediated Allele Detail
|
Symbol: |
Col1a1em1Lmjn |
Name: |
collagen, type I, alpha 1; endonuclease-mediated mutation 1, Lauryl Nutter |
MGI ID: |
MGI:7565728 |
Synonyms: |
Col1a1em2Tcp |
Gene: |
Col1a1 Location: Chr11:94827050-94843868 bp, + strand Genetic Position: Chr11, 59.01 cM, cytoband D
|
Alliance: |
Col1a1em1Lmjn page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
Mutation: |
|
Insertion
|
|
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence GAGGTTCATGAGCCCTCAAA and an AAV repair template to insert a Bxb1 IMCE cassette comprised of a Bxb1 attP-GT site, a spacer sequence, and a Bxb1 attP-GA stie. This resulted in insertion of the Bxb1 IMCE cassette after Chr11:94844348 (GRCm39). This insertion should enable Bxb1 integrase-mediated cassette exchange with an appropriate vector and Bxb1 mRNA.
(J:322048)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Col1a1 Mutation: |
166 strains or lines available
|
|
Original: |
J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022; |
All: |
1 reference(s) |
|