Irx1^em2Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Irx1^em2Tcp
• Name: Iroquois homeobox 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:7565727
• Gene: Irx1 Location: Chr13:72106351-72111842 bp, - strand Genetic Position: Chr13, 38.43 cM
• Alliance: Irx1^em2Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and guide RNAs with spacer sequences of UGGUGAAUCAAGUGCCCCCA targeting the 5' side and UCCAAGGGCUUGUUCCACGG targeting the 3' side of exon 2 (ENMUSE00000487192) resulting in deletion of Chr13:72107210-72108528 (GRCm38). (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Irx1 Mutation: 22 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)