About   Help   FAQ
Irx1em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Irx1em1Tcp
Name: Iroquois homeobox 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7565726
Gene: Irx1  Location: Chr13:72106351-72111842 bp, - strand  Genetic Position: Chr13, 38.43 cM
Alliance: Irx1em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by injecting Cas9 protein with guide RNAs with spacer sequences of UGGUGAAUCAAGUGCCCCCA targeting the 5' side and UCCAAGGGCUUGUUCCACGG targeting the 3' side of exon 2 (ENMUSE00000487192) and a plasmid repair template targeted by a single guide RNA with the protospacer sequence GGCGAGGGCGATGCCACCTA in the plasmid backbone. The resultant allele is a loxP-flanked exon 2 with loxP sites inserted after Chr13:72108521 and Chr13: 72107212 (GRCm39). (J:344138)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Irx1 Mutation:  22 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory