Irx1^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Irx1^em1Tcp
• Name: Iroquois homeobox 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7565726
• Gene: Irx1 Location: Chr13:72106351-72111842 bp, - strand Genetic Position: Chr13, 38.43 cM
• Alliance: Irx1^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by injecting Cas9 protein with guide RNAs with spacer sequences of UGGUGAAUCAAGUGCCCCCA targeting the 5' side and UCCAAGGGCUUGUUCCACGG targeting the 3' side of exon 2 (ENMUSE00000487192) and a plasmid repair template targeted by a single guide RNA with the protospacer sequence GGCGAGGGCGATGCCACCTA in the plasmid backbone. The resultant allele is a loxP-flanked exon 2 with loxP sites inserted after Chr13:72108521 and Chr13: 72107212 (GRCm39). (J:344138)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Irx1 Mutation: 22 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 2 reference(s)