Slco5a1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
Symbol: |
Slco5a1em1(IMPC)Tcp |
Name: |
solute carrier organic anion transporter family, member 5A1; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
MGI ID: |
MGI:7565679 |
Gene: |
Slco5a1 Location: Chr1:12936773-13062874 bp, - strand Genetic Position: Chr1, 3.71 cM
|
Alliance: |
Slco5a1em1(IMPC)Tcp page
|
IMPC: |
Slco5a1 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AATTTAGTGGTTCTAGAGCG targeting the 5' side and ACGGCCTCTACAAGTTAGGG targeting the 3' side of a critical region (ENSMUSE00001327733). This resulted in a 740-bp deletion of Chr1 from 13013818 to 13014557 with insertion of AGGA at the deletion junction (GRCm39). Absence of this exon from mRNA is predicted to introduce a frameshift and premature stop codon.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
1 reference(s) |
|