Hgsnat^em1Avps
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hgsnat^em1Avps
• Name: heparan-alpha-glucosaminide N-acetyltransferase; endonuclease-mediated mutation 1, Alexey Pshezhetsky
• MGI ID: MGI:7565614
• Synonyms: Hgsnat^P304L
• Gene: Hgsnat Location: Chr8:26434481-26466781 bp, - strand Genetic Position: Chr8, 14.22 cM
• Alliance: Hgsnat^em1Avps page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Proline codon 304 (CCA) in exon 9 was changed to leucine (CTA) (c.911C>T, p.P304L) using an sgRNA (targeting TGGCCGACCTCGTCTTCCCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.P311L mutation associated with mucopolysaccharidosis IIIC (MPS IIIC) (Sanfilippo syndrome type C). (J:343336)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hgsnat Mutation: 39 strains or lines available

References

• Original: J:343336 Pan X, et al., Glucosamine amends CNS pathology in mucopolysaccharidosis IIIC mouse expressing misfolded HGSNAT. J Exp Med. 2022 Aug 1;219(8)
• All: 3 reference(s)