About   Help   FAQ
Hgsnatem1Avps
Endonuclease-mediated Allele Detail
Summary
Symbol: Hgsnatem1Avps
Name: heparan-alpha-glucosaminide N-acetyltransferase; endonuclease-mediated mutation 1, Alexey Pshezhetsky
MGI ID: MGI:7565614
Synonyms: HgsnatP304L
Gene: Hgsnat  Location: Chr8:26434481-26466781 bp, - strand  Genetic Position: Chr8, 14.22 cM
Alliance: Hgsnatem1Avps page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsProline codon 304 (CCA) in exon 9 was changed to leucine (CTA) (c.911C>T, p.P304L) using an sgRNA (targeting TGGCCGACCTCGTCTTCCCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.P311L mutation associated with mucopolysaccharidosis IIIC (MPS IIIC) (Sanfilippo syndrome type C). (J:343336)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Hgsnat Mutation:  39 strains or lines available
References
Original:  J:343336 Pan X, et al., Glucosamine amends CNS pathology in mucopolysaccharidosis IIIC mouse expressing misfolded HGSNAT. J Exp Med. 2022 Aug 1;219(8)
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory