Ager^em1Xulab
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ager^em1Xulab
• Name: advanced glycosylation end product-specific receptor; endonuclease-mediated mutation 1, Ding Xu
• MGI ID: MGI:7565599
• Synonyms: Ager^AHA
• Gene: Ager Location: Chr17:34816836-34819910 bp, + strand Genetic Position: Chr17, 18.18 cM
• Alliance: Ager^em1Xulab page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codons 214 (CGG), 215 (CGC) and 216 (AGA) in exon 6 were changed to alanine (GCA), histidine (CAT) and alanine (GCT) (p.R214_R216delinsAHA), respectively, using an sgRNA (targeting GGGGCCGCGTCTGGGGACTTGTG) and an ssODN template with CRISPR/Cas9 technology. The mutations in the C1 domain of the encoded peptide render it heparan sulfate (HS)-binding deficient which blocks oligomerization. (J:343334)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ager Mutation: 28 strains or lines available

References

• Original: J:343334 Li M, et al., Heparan sulfate-dependent RAGE oligomerization is indispensable for pathophysiological functions of RAGE. Elife. 2022 Feb 9;11:e71403
• All: 1 reference(s)