Slc13a5^{em1(SLC13A5)Lutzy}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc13a5^{em1(SLC13A5)Lutzy}
• Name: solute carrier family 13 (sodium-dependent citrate transporter), member 5; endonuclease-mediated mutation 1, Catherine Lutz
• MGI ID: MGI:7565448
• Gene: Slc13a5 Location: Chr11:72132815-72158048 bp, - strand Genetic Position: Chr11, 43.95 cM
• Alliance: Slc13a5^{em1(SLC13A5)Lutzy} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Inserted expressed sequence, Null/knockout)
• Mutation: Insertion
• Slc13a5^{em1(SLC13A5)Lutzy} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  SLC13A5 (284111)

  Slc13a5

  (MGI:3037150)

• Mutation details: CRISPR/cas9 genome editing used guide RNAs (CGCCGAATCCATCGCGTGAA, GCCGAATCCATCGCGTGAAA, TGCGTGTCTGGGCAGCCTGG, AGTTGCGTGTCTGGGCAGCC) to excise and replace coding murine exon 1 with a full-length 568 amino acid WT human SLC13A5cDNA with bGH poly(A) transcription termination signal. The insertion prevents translation of the mouse Slc13a5 cDNA. Slc13a5 transcript Slc13a5-201 (ENSMUST00000021161.14) was used as reference for the exon number and guide sequences. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc13a5 Mutation: 36 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)