Slc13a5em1(SLC13A5)Lutzy
Endonuclease-mediated Allele Detail
|
Symbol: |
Slc13a5em1(SLC13A5)Lutzy |
Name: |
solute carrier family 13 (sodium-dependent citrate transporter), member 5; endonuclease-mediated mutation 1, Catherine Lutz |
MGI ID: |
MGI:7565448 |
Gene: |
Slc13a5 Location: Chr11:72132815-72158048 bp, - strand Genetic Position: Chr11, 43.95 cM
|
Alliance: |
Slc13a5em1(SLC13A5)Lutzy page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence, Inserted expressed sequence, Null/knockout) |
Mutation: |
|
Insertion
|
|
|
Slc13a5em1(SLC13A5)Lutzy expresses
1 gene
Knock-in expresses:
Organism |
Expressed Gene |
Homolog in Mouse |
Note |
human |
SLC13A5 (284111) |
|
|
|
|
|
Mutation details: CRISPR/cas9 genome editing used guide RNAs (CGCCGAATCCATCGCGTGAA, GCCGAATCCATCGCGTGAAA, TGCGTGTCTGGGCAGCCTGG, AGTTGCGTGTCTGGGCAGCC) to excise and replace coding murine exon 1 with a full-length 568 amino acid WT human SLC13A5cDNA with bGH poly(A) transcription termination signal. The insertion prevents translation of the mouse Slc13a5 cDNA. Slc13a5 transcript Slc13a5-201 (ENSMUST00000021161.14) was used as reference for the exon number and guide sequences.
(J:94077)
|
|
|
|
Original: |
J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015; |
All: |
1 reference(s) |
|