Polg^em5Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polg^em5Lutzy
• Name: polymerase (DNA directed), gamma; endonuclease-mediated mutation 5, Cathy Lutz
• MGI ID: MGI:7565444
• Synonyms: Polg^R292C
• Gene: Polg Location: Chr7:79095979-79116110 bp, - strand Genetic Position: Chr7, 45.04 cM, cytoband E
• Alliance: Polg^em5Lutzy page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:366852
• Parent Cell Line: JM8A3 (ES Cell)
• Strain of Origin: C57BL/6N-A^tm1Brd

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing used guide RNAs (CTCCCATCCACAGGCTGCGC and TTCCAGCGCAGCCTGTGGAT) to cleave DNA and a single stranded oligo donor with the silent F290F (TTC to TTT) variant and missense R292C (CGC to TGC; arginine to cysteine) variant in exon 4.The mutation is homologous to human R309C and is associated with Polg-related mitochondrial disorders. (J:366852)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Polg Mutation: 59 strains or lines available

References

• Original: J:366852 VanPortfliet JJ, et al., Caspase-11 drives macrophage hyperinflammation in models of Polg-related mitochondrial disease. Nat Commun. 2025 May 20;16(1):4640
• All: 1 reference(s)