Irx3^em1Jbri
Endonuclease-mediated Allele Detail

Summary

• Symbol: Irx3^em1Jbri
• Name: Iroquois related homeobox 3; endonuclease-mediated mutation 1, James Briscoe
• MGI ID: MGI:7564250
• Gene: Irx3 Location: Chr8:92525139-92528282 bp, - strand Genetic Position: Chr8, 44.55 cM
• Alliance: Irx3^em1Jbri page

Mutation origin

• Strain of Origin: 129P2/OlaHsd-Hprt1^b-m3

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: An integration of a HA tag at the 3 ' end of the coding region of Olig2 Cas9 protein was injected directly into the blastocysts, together with guide RNAs (cgtcttaacttttcaaccat) and single-stranded DNA oligos of around 170 bp length, which carried the HA coding sequence flanked by sequences homologous to the region surrounding the natural stop codon of the corresponding gene. (J:343153)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Irx3 Mutation: 24 strains or lines available

References

• Original: J:343153 Garcia-Perez L B, A quantitative analysis of tissue development: understanding the role of two mutually repressing transcription factors, Irx3 and Olig2, in the developing spinal cord. PhD Thesis - Imperial College London. 2022
• All: 1 reference(s)