About   Help   FAQ
Irx3em1Jbri
Endonuclease-mediated Allele Detail
Summary
Symbol: Irx3em1Jbri
Name: Iroquois related homeobox 3; endonuclease-mediated mutation 1, James Briscoe
MGI ID: MGI:7564250
Gene: Irx3  Location: Chr8:92525139-92528282 bp, - strand  Genetic Position: Chr8, 44.55 cM
Alliance: Irx3em1Jbri page
Mutation
origin
Strain of Origin:  129P2/OlaHsd-Hprt1b-m3
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsAn integration of a HA tag at the 3 ' end of the coding region of Olig2 Cas9 protein was injected directly into the blastocysts, together with guide RNAs (cgtcttaacttttcaaccat) and single-stranded DNA oligos of around 170 bp length, which carried the HA coding sequence flanked by sequences homologous to the region surrounding the natural stop codon of the corresponding gene. (J:343153)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Irx3 Mutation:  29 strains or lines available
References
Original:  J:343153 Garcia-Perez L B, A quantitative analysis of tissue development: understanding the role of two mutually repressing transcription factors, Irx3 and Olig2, in the developing spinal cord. PhD Thesis - Imperial College London. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory