Rnase4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnase4^em1(IMPC)J
• Name: ribonuclease, RNase A family 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7562150
• Gene: Rnase4 Location: Chr14:51328534-51343608 bp, + strand Genetic Position: Chr14, 26.37 cM, cytoband C1
• Alliance: Rnase4^em1(IMPC)J page
• IMPC: Rnase4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCACTCTCAGAGAAAG and GTATTTGACCAGAATGTATA, which resulted in a 1570 bp deletion beginning at Chromosome 14 position 51,104,659 bp and ending after 51,106,228 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001429614 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor start site and termination site and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rnase4 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)