Tpbglem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tpbglem1(IMPC)J |
Name: |
trophoblast glycoprotein-like; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7562143 |
Gene: |
Tpbgl Location: Chr7:99273289-99276310 bp, - strand Genetic Position: Chr7, 54.11 cM
|
Alliance: |
Tpbglem1(IMPC)J page
|
IMPC: |
Tpbgl gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GAGACCCGAGCCTGGAGAAG and CCCCGCGCGCGGGACAGCGG, which resulted in a 1131 bp deletion beginning at Chromosome 7 position 99,625,502 bp and ending after 99,626,632 bp (GRCm38/mm10). This mutation deletes 1131 bp from ENSMUSE00001008045 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4, delete 378 amino acids, then return into frame for the last 2 amino acids before the stop codon.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|