Rbck1^em1Pcoh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbck1^em1Pcoh
• Name: RanBP-type and C3HC4-type zinc finger containing 1; endonuclease-mediated mutation 1, Philip Cohen
• MGI ID: MGI:7562041
• Synonyms: HOIL-1[C458S]
• Gene: Rbck1 Location: Chr2:152158254-152174573 bp, - strand Genetic Position: Chr2, 74.83 cM
• Alliance: Rbck1^em1Pcoh page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Cysteine codon 458 (TGT) in exon 12 (in ENSMUST00000028964) was changed to serine (AGC) (p.C458S) using an sgRNA (targeting AGAAGAAGGACGGCTGTGACTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation creates an E3 ligase-inactive form of the encoded peptide. (J:277157)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rbck1 Mutation: 43 strains or lines available

References

• Original: J:277157 Kelsall IR, et al., The E3 ligase HOIL-1 catalyses ester bond formation between ubiquitin and components of the Myddosome in mammalian cells. Proc Natl Acad Sci U S A. 2019 Jul 2;116(27):13293-13298
• All: 3 reference(s)