Zc3h12a^em1Aki
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zc3h12a^em1Aki
• Name: zinc finger CCCH type containing 12A; endonuclease-mediated mutation 1, Shizuo Akira
• MGI ID: MGI:7562019
• Synonyms: Regnase-1^S513A
• Gene: Zc3h12a Location: Chr4:125012216-125021633 bp, - strand Genetic Position: Chr4, 58.1 cM
• Alliance: Zc3h12a^em1Aki page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Serine codon 513 (TCT) in exon 6 was changed to alanine (GCT) (p.S513A) using sgRNAs (targeting GTGGGTGGGGGTAATGGGTA and CCTACCCATCCAGAGTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks phosphorylation of the affected residue in the encoded peptide. (J:277918)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zc3h12a Mutation: 34 strains or lines available

References

• Original: J:277918 Tanaka H, et al., Phosphorylation-dependent Regnase-1 release from endoplasmic reticulum is critical in IL-17 response. J Exp Med. 2019 Jun 3;216(6):1431-1449
• All: 1 reference(s)